Right and left primer

Primers are always directed from 5′ to 3′ which means from left to right. The 5′ ends of primers bind to the 3′ end DNA strand. These two primers oriented towards each other.

The left primer must have the same sequence as the top strand from 5′ to 3′ and binds through complementary base pairing. The right primer has same sequence as the bottom strand which is from 5′ to 3′.

Example:

5′- TCTGAACGACAACCTCCTCCA CAGAGTGGTGCCTCATGGACA GGACTTCAGAGGC-3′

Right and left primers for the above sequence is:

Left primer

5-TCTGAACGACAACCTCCTCC-3

Right primer

5′-GCCTCTGAAGTCCTGTCCAT-3′

Leave a Reply

Your email address will not be published.